A Clorose Variegada dos Citros (CVC) é uma doença economicamente importante e destrutiva no Brasil e é causada pela bactéria Xylella fastidiosa e transmitida por insetos vetores tal como Oncometopia facialis. Nesse estudo, a eficácia do fungo Metarhizium anisopliae em controlar o inseto vetor O. facialis foi estudada em condições de bioensaio. Nesse bioensaio, insetos foram pulverizados com uma suspensão de 5 X 10(7) conídio mL-1. Insetos-adultos capturados no campo foram tratados em grupos de 10, em um total de 11 replicatas por tratamento. Diferenças significativas entre a mortalidade natural e a mortalidade dos insetos tratados com o fungo foram observadas em 6 dias após a inoculação (P<0.05). Estas diferenças significativas aumentaram antes do décimo dia após o tratamento. O fungo causou uma mortalidade de 87,1%, com uma LT50 variando entre 5 e 6 dias. A LC50 foi de 1,2 X 10(6) conídio mL-1, variando de 7,7 X 10(5) a 2 X 10(6) conídio mL-1. Estes resultados mostraram que o vetor O. facialis foi susceptível a ação entomopatogênica de M. anisopliae em condições controladas durante o bioensaio.

Citrus Variegated Chlorosis (CVC) is an economically important, destructive disease in Brazil and is caused by Xylella fastidiosa and transmitted by sharpshooter insects. In this study, the efficacy of the fungus Metarhizium anisopliae in controlling the sharpshooter Oncometopia facialis was studied by bioassay conditions. In the bioassay, insects were sprayed with a suspension containing 5 X 10(7) conidia mL-1. Adults captured in the field were treated in groups of 10 in a total of 11 replications per treatment. Significant differences between the natural mortality and the mortality of insects treated with the fungus were observed 6 days after inoculations (P<0.05). These significant differences increased until 10 days after treatment. The fungus caused 87.1% mortality, with the LT50 varying from 5 to 6 days. The LC50 was 1.2 X 10(6) conidia mL-1, varying from 7.7 X 10(5) to 2 X 10(6) conidia mL-1. The results showed that the sharpshooter O. facialis was susceptible to the entomopathogenic action of M. anisopliae in controlled condition during bioassay.

O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales) linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae), contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS) e não autoclavado (NAS) de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10) para AS e 2,52 x 10(10) para NAS. A concentração letal (LC50) expressa pela concentração de conídios, foi 8,44 x 10(9) conídios/g de solo para AS e 12,2 x 10(9) conídios/g/S para NAS.

The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales) strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae), against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS) and non-autoclaved (NAS) soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10) for AS and 2.52 x 10(10) for NAS. The lethal concentration (LC50), expressed as conidia concentration, was 8.44 x 10(9) conidia/g of soil (S) for AS and 12.23 x 10(9) conidia/g of soil for NAS.

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

Dois estágios de desenvolvimento a saber: conídio (C) e micélio (M) em 10 linhagens de Metarhizium anisopliae var. anisopliae e 2 M. anisopliae var. majus, foram estudados em dois diferentes meios de cultivos, minimo (MM) e completo (MC). As linhagens apresentaram-se similares quanto a porcentagem de lipídios totais, porém submetidas ao teste de Tukey, as médias dos conteúdos de lipídios do conídio (C) e do micélio (M) cultivados em meio MM e CM respectivamente, mostraram diferença significativa ao nível de 5% , indicando assim variabilidade para a produção de lipídios totais. As linhagens 5 e 7, ambas da var. majus, não apresentam diferenças mensuráveis da variedade anisopliae. Com os ácidos graxos C18:1 e C18:2 oléico e linoléico respectivamente, as diferenças foram todas altamente significativas (p= 1%) com a mais alta média de C18:1 para conídio e C18:2 para micélio.

Two growth stages, conidia (C) and mycelium (M), and two media, minimal medium (MM) and complete medium (MC), were compared in 10 strains of M. anisopliae, and two strains of M. anisopliae var. majus were similar in percentages of total lipids. Tukey test for average of lipid content in conidia (C) and mycelia (M) cultured on minimal (MM) and complete (MC) media showed significant differences between means at the 5% level for mycelia and conidia, indicating variability in total lipid production and storage during growth. Strains 5 and 7, both variety majus, did not present sizable differences from variety anisopliae. For fatty acids, C18:1 and C18:2, oleic and linoleic, respectively, the differences were all highly significant (p= 1%) with the highest means being obtained for conidia for fatty acid C18:1 and for myclelia for fatty acid C18:2.